The first clonal spread of vanA-positive Enterococcus raffinosus in a nursing home.
نویسندگان
چکیده
In a recent issue of this Journal, Jolivet and colleagues reported the first nosocomial outbreak of vanA-type vancomycinresistant Enterococcus raffinosus in France [1]. We would like to report a vanA-positive E. raffinosus outbreak that is not only the first in Belgium but, to our knowledge, is also the first to be reported in a nursing home anywhere in the world. We also tabulate a literature search on previous E. raffinosus outbreaks worldwide. Vancomycin-resistant enterococci (VRE) are important nosocomial pathogens and the treatment option for VRE infections is limited [2]. Invasive infections caused by VRE are associated with higher mortality than those caused by vancomycin-susceptible enterococci (VSE) [2]. Outbreaks of VRE usually occur in hospital settings caused by E. faecium and E. faecalis [2]. The most frequently reported resistance genotypes responsible for acquired resistance to vancomycin are vanA and vanB [2]. The vanA gene is responsible for high-level resistance to glycopeptides vancomycin and teicoplanin. Outbreaks of VRE due to species other than E. faecium and E. faecalis are rarely reported. E. raffinosus is another species of Enterococcus that has been linked to severe infections such as endocarditis [3]. In the spring of 2015, the Belgian National Reference Center (NRC) for Enterococci received two E. raffinosus strains for confirmation of vancomycin resistance from two different hospitals within a distance of 30 km (18miles). E. raffinosus was confirmed in the NRC using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (Bruker Daltonik GmbH, Bremen, Germany). These isolates were also positive for vanA genes as detected using specific polymerase chain reaction primers with forward sequence AAAATGTGCGAAAAACCTTG, and reverse sequence AAACATATCCACACGGGCTA [4] . The first strain originated from a screening sample from a patient in hospital 1. The VRE screening was performed in that hospital due to an outbreak of vanA-positive E. faecium. The second strain originated from a patient who received haemodialysis in hospital 2; this hospital had also implemented VRE
منابع مشابه
Comparison of two chromogenic media for the detection of vancomycin-resistant enterococcal carriage by nursing home residents
We compared ChromID VRE and Brilliance VRE media for the detection of vancomycin-resistant enterococci (VRE). Using a panel of 28 enterococcal isolates, 10 vanA Enterococcus faecium and three vanA Enterococcus faecalis isolates grew as per manufacturers' instructions whilst growth of two vanC and eight vancomycin-susceptible enterococci was inhibited on both media. Important differences were no...
متن کاملFirst case of vanA-positive Enterococcus mundtii in human urinary tract infection in Iran
We cultured enterococci from urinary tract infections in Iranian hospitals. Seven different Enterococcus species (E. raffinosus, E. durans, E. hirae, E. avium, E. mundtii, E. faecium and E. faecalis) were found. Seven strains were vancomycin resistant, leading to an overall vancomycin resistance rate of 3.9%. The enterococcal infection rate was high and vancomycin-resistant enterococci incidenc...
متن کاملVancomycin-resistant enterococci among haemodialysis patients in Portugal: prevalence and molecular characterization of resistance, virulence and clonality.
INTRODUCTION Vancomycin-resistant enterococci (VRE) among haemodialysis patients has increased rapidly and, to date, there is no report of this incidence in Portugal. METHODS A total of 121 faecal samples were collected from haemodialysis patients, and then tested for VRE. Antimicrobial resistance, virulence and multilocus sequence typing (MLST) were studied. RESULTS VRE prevalence was 3.3%...
متن کاملHospital outbreak of vancomycin-resistant enterococci caused by a single clone of Enterococcus raffinosus and several clones of Enterococcus faecium.
A mixed outbreak caused by vancomycin-resistant Enterococcus raffinosus and Enterococcus faecium carrying the vanA gene was analysed. The outbreak occurred in a large hospital in Poland and affected 27 patients, most of whom were colonised, in three wards, including the haematology unit. The E. raffinosus isolates had a high-level multiresistant phenotype and were initially misidentified as Ent...
متن کاملCharacterization of glycopeptide-resistant enterococci from U.S. hospitals.
We examined 105 clinical isolates of glycopeptide-resistant enterococci collected from 31 U.S. hospitals in 14 states during May 1988 to July 1992. The isolates included 82 Enterococcus faecium, 8 E. faecalis, 6 Enterococcus spp., 5 E. gallinarum, 3 E. casseliflavus, and 1 E. raffinosus. The isolates were categorized into the following four phenotypes of glycopeptide resistance on the basis of ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- The Journal of hospital infection
دوره 96 1 شماره
صفحات -
تاریخ انتشار 2017