The first clonal spread of vanA-positive Enterococcus raffinosus in a nursing home.

In a recent issue of this Journal, Jolivet and colleagues reported the first nosocomial outbreak of vanA-type vancomycinresistant Enterococcus raffinosus in France [1]. We would like to report a vanA-positive E. raffinosus outbreak that is not only the first in Belgium but, to our knowledge, is also the first to be reported in a nursing home anywhere in the world. We also tabulate a literature search on previous E. raffinosus outbreaks worldwide. Vancomycin-resistant enterococci (VRE) are important nosocomial pathogens and the treatment option for VRE infections is limited [2]. Invasive infections caused by VRE are associated with higher mortality than those caused by vancomycin-susceptible enterococci (VSE) [2]. Outbreaks of VRE usually occur in hospital settings caused by E. faecium and E. faecalis [2]. The most frequently reported resistance genotypes responsible for acquired resistance to vancomycin are vanA and vanB [2]. The vanA gene is responsible for high-level resistance to glycopeptides vancomycin and teicoplanin. Outbreaks of VRE due to species other than E. faecium and E. faecalis are rarely reported. E. raffinosus is another species of Enterococcus that has been linked to severe infections such as endocarditis [3]. In the spring of 2015, the Belgian National Reference Center (NRC) for Enterococci received two E. raffinosus strains for confirmation of vancomycin resistance from two different hospitals within a distance of 30 km (18miles). E. raffinosus was confirmed in the NRC using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (Bruker Daltonik GmbH, Bremen, Germany). These isolates were also positive for vanA genes as detected using specific polymerase chain reaction primers with forward sequence AAAATGTGCGAAAAACCTTG, and reverse sequence AAACATATCCACACGGGCTA [4] . The first strain originated from a screening sample from a patient in hospital 1. The VRE screening was performed in that hospital due to an outbreak of vanA-positive E. faecium. The second strain originated from a patient who received haemodialysis in hospital 2; this hospital had also implemented VRE